Ben Neden Sen Değilim

– geçen gün aklıma ilginç bir fikir geldi evrenin varoluşunu ve hayatın anlamını açıklamaya yönelik. durup dururken aklıma gelen bir fikirden dallanan bir teori. eğlenmek için şunu bir kitap yapsam diye düşünmeye başladım. üşenmezsem belki bir gün…

– nasıl bir teori bu?

– uncompressing theory adını verdim. bu teoriye göre evrenin şu anki işleyişi aslında bir unzip süreci. evrende incelersen harika sıkıştırma algoritmaları mevcut. koca bir organizmanın tek bir dna sarmalına kodlanabilmesi mesela. bu örneği genişletip en ucuna gidersen karşına big bang çıkıyor. tüm evreni bir noktaya sıkıştırabilecek ölçüde güçlü bir sıkıştırma algoritması. birileri bunu uncompress etmeye başladı. bitince ne çıkacak ortaya bilmiyoruz ama evrenin sürekli genişlemesi hep bu sürecin sonucu. biz de bu henüz tamamlanmamış algoritmada subroutinelerden ibaretiz. kader dediğimiz şey bizim loglarımızdan ibaret. kader var, çünkü hepimiz tam olarak yapmamız istenen şeyi yapıyoruz.

– hmm hiç fena değil… şimdi ben biraz daha karıştırayım aklını… DNAlar ile başladın… devam edeyim… hücreler içerisinde C, A, T, G tipinde 4 yapı vardır… yani herşey, bütün o sarmallar, bu 4 temel yapı taşından oluşan string’lerdir aslında… mesela, …CATTGACTCGGATCGCGATCGA… gibi… güzel bir örnek vereyim bu konuda… kanda besin taşımakla yükümlü bir madde var (ismini hatırlamıyorum)… ve bu madde kepçe şeklinde… çünkü kepçe formundayken besinleri elverişli bir şekilde taşıyabiliyor… bu maddeyi oluşturan (yine yanlış hatırlamıyorsam) 180 tane yapı var… C, A, T, T, G, A, C, T diye 179 tanesini diziyorsun hiçbirşey olmuyor. 180.yi eklediğin anda kendi kendine bükülüp kepçe şeklini alıyor. ben olaya programcı olarak bakıyorum… demek ki, doğaya gizlenmiş bir takım API’ler var. bu API’leri kullanmayı genetik mühendisleri yavaş yavaş öğreniyorlar. bir nevi, doğa programcılığı…

– bazı dna’lar deşifre edildi malum. sirke sineği kör kurtçuk mu ne, tüm DNA kodu elimizde. acaba bu sıkıştırılabilir mi? yani şu ATGC’lerin dizilimini tekrar bir sıkıştırsak ne kadar verim alırdık? mesela mp3 ziplersin ama küçültemezsin. bunlar da öyle olabilir mi?

– muhtemelen öyledir. zira zaten ne kadar sıkışmış bir baksana! ayrıca şöyle de bir nokta var… yine programcı olarak bakıyorum… şimdi bir insana bakıyorsun… aslında gördüğün şey karşındaki şey değil; karşındaki şeyin, senin algıların tarafından yaratılmış bir özeti… bir el görüyorsun… ama aslında o elde bir sürü hücre var kıpır kıpır… hücreye daha yakından baktığında, CATG’ler görüyorsun… onlara daha yakından baktığında proteinler vs görüyorsun… onlara daha yakından baktığında atomlar görüyorsun… atomlara daha yakından baktığında atom altı parçacıklar görüyorsun – ki bunların arasında bir ortaya çıkan bir kaybolan hayalet parçacıklar da var. söylemek istediğim; daha derine baktıkça, nesneler / canlılar / vs arasındaki farklılıklar gittikçe küçülüyor. bir noktada, (maddi veya madde dışı, veya aynı anda ikisi birden) ortak tek bir hammadde var. o halde, aslında etrafımızda olup biten şeyler diye gördüğümüz şeyler, aslında bu “bir”in çeşitli şekillerde ifade bulmasından ibaret. aynen programların en derininde yer alan bir (ve sıfır) gibi.

– doğru, ama bu bizim düşünebldiğimiz boyutta böyle. evrenin yapıtaşı, sadece bir noktanın varlığından veya yokluğundan ibaret olmayabilir. hayal edemeyeceğimiz çok değişik bir şey de olabilir. mesela quntum fiziğinde çok ilginç deneyler var. bir ayna düzeneği oluşturup tek bir foton gönderiyorlar. iki adet alıcı var ve foton düzenek fotunun tek bir anda sadece birine ulaşabileceği biçimde. tek bir foton gönderiyorlar, iki alıcı birden foton algılıyor. çok ilginç.

– birçok mucizeyi açıklıyor öyle değil mi?

– M theory diye birşey var, bilir misin? 1800’lü yıllarda yaşamış ünlü bir matematikçinin tozlu raflarında kalan bir formülü izleyerek evrende maddeyi oluşturan en küçük parçanın ne olduğunu bulmaya çalışıyorlar. 1995 civarında M thory ile bu baya olgunlaştı. çok ilginç bir sonuç çıktı ortaya. maddeyi oluşturan temel parçacığın bir nokta değil, sürekli hareket eden bir enerji halkası olduğu ortaya çıkıyor. boyutu için bir atom çekirdeğini güneş sistemi olarak düşünürsen, string adı verilen bu parçacık dünya üzerinde bir ağaç kadar kalır diyorlar. son yorum ise harika: stringler birer ses dalgasını andıran parçaçıklar olduğundan, tüm evrenin aslında kusursuz olarak icra edilen bir senfoniden başka bir şey olmayabileceği söyleniyor. biraz şiirsel, ama hoş.

– o halde string’lerin de altında belki bir başka güneş sistemi ve daha da küçük başka şeyler var… ve bu sonsuza kadar küçüle küçüle gidiyor da olabilir.

– evet. büyüyor da olabilir ayrıca.

– yani daha ışığın ne olduğunu bile bilmiyoruz… ışığın hammaddesi nedir? enerjinin hammaddesi nedir? benim teorim, gidebildiğin kadar derine gittiğinde, hepsinin hammaddesinin aynı şey olacağı… sırf maddeden bahsetmiyorum…

– düşünecek ne kadar çok şey var… arkada çocuk gülümsüyor, gözümde görüntü önümde monitör aklımda düşünceler kulağımda sesler… hepsi ama hepsi biyokimyasal reaksiyonlardan ibaret. glukoz hücreye giriyor o enzim onu tutuyor bu buna yapışıyor ben düşünüyorum. çok garip….

– esas zor soru ne biliyor musun? madem hammadde ortak, “benlik” ile “senlik” arasındaki fark nedir? nasıl oluyor da “ben” kendimi “ben dışında kalan herşey”den izole bir şekilde deneyimliyorum? aynı şekilde “sen” kendini “sen dışında kalan herşey”den izole bir şekilde deneyimliyorsun? neden ben “senliği” yaşamıyorum, sen de “benliği” yaşamıyorsun?

– çünkü böyle olması önceden planlanmış.

– elbette… ama nasıl “mümkün” oluyor?

– birer subroutine olarak etrafta geziyoruz ve aynı yongadaki address space’i paylaşmamıza rağmen farklı bellek konumları üzerindeyiz. bakınca aynı görünüyoruz ama farklı bir şey için varız. ben sadece benim için planlanmış olanı yapıyorum, sen de senin için planlanmış olanı.

– doğru… ama yine de enteresan… kolektif bilinçten soyutlanmış gibiyiz yani?

– kollektif bilici nasıl tanımladığına bakar bu. ölüm belki bir veri değerlendirme sürecidir.

– ama bu tam olarak sorduğum sorunun cevabı değil… ben çok daha temel birşeyi soruyorum. aynı hammaddeye sahipsek, tek bir kollektif bilinçten izole edildiysek, ben izole edildiğim anda neden “benlik”i yaşamaya başladım da “senlik”i yaşamaya başlamadım? bu biraz bakterilerin bölünmesi gibi… bir bakteri bölündüğü anda, bir parça sağa bir parça sola gider. bölünmeden hemen önce “ben” diyen bakteri, sağa giderek “ben” demeye devam ederken soldaki “bir başka ben” demeye başlar. ama aslında ikisi de aynı “ben”dir.

– eğer benlik yaşamaya başlasaydın, ben sen olacaktın. belki de yaşadın. belki yer değiştirdik herşeyin başladığı yerde. nasıl emin olabilirsin? nasıl bilebilirsin?

– bilemezsin… ama izolasyonun nasıl olup da mümkün olabildiğini merak ediyorum. bu konudaki teorim, birbirine bakan bir çift göz teorisi… ya da bağlı olduğu TVyi çeken bir kamera… süje kendi kendini algıladığı anda sonsuz bir döngüye girer ve “ben” demeye başlar. illüzyondur yani. bu benim cevabım.

– hmm benin farkına varmak senle başlar ama. başkalarından farklı olduğunu görmek zorunda olmadığın sürece benin ne olduğunu algılamak, anlamak zorunda hissetmezsin kendini.

– hiçbir insanla tanışmadan bir adada doğup büyümüş biri için de geçerli ama “ben” duygusu. ağaca taş atıyor canı yanmıyor, kendi kafasına taş gelince canı yanıyor. “ağaç ben değil, ama kafam ben” diyor o zaman. senin dediğin anlamda olmasa da, benim dediğim anlamda “ben” diyor yani robinson.

– peki… bütün sistemleri ve organlarıyla insan gibi kompleks bir canlıyı mı tek hücreye sıkıştırmak zordur, yoksa bir nsanın hayatı boyunca duyduğu her sesi, gördüğü her şey, aklından geçen her düşünceyi bir hücreye sığdırmak mı? bu soruya cevap verirken toplam kan dolaşım sisteminin kırk kilometre, sinir ağının bir o kadar, toplam beyin hücresi sayısının bilmem kaç milyar vs olduğunu düşünerek değerlendirirsen…

– insana ait bütün bilgiler tek bir hücrede toplanabildiği, ve gelişen tek bir hücreden insan denen varlık ortaya çıkabildiği gibi, evrenin tamamı da küçücük bir noktadan ortaya çıkmıştır (big bang). dolayısıyla; evrenin neresinde ne olup bittiği (ve biteceği), aslında o patlamanın parametrelerinden, yan etkilerinden başka birşey değildir. olup biten herşey zaten patlamadan önceki noktanın içerisinde idi. topkı insan hücreleri gibi. bu yüzden ikisi aynı şey, birbirinden daha zor veya kolay değil. insanın hayatı boyunca duyduğu gördüğü vs herşey, kendisi de, kendi hücreleri de, herşey de, ortak özün sonsuz yoğunluktaki halinde zaten vardı. sadece ifade buldular bu şekilde.

– bunu sormamın sebebi şu… bir insanın hayatında duyduğu her sesi, gördüğü her şeyi ve aklından geçmiş tüm düşünceleri boş bir beyne yüklersen o insanı yeniden yaratmış olursun.

– doğru. geçmişimizin tek ispatı anılarımızdır.

– sonuçta insanı “ben” yapan yaşadıkları ve bu yaşadıklarının üzerinde bıraktıkları.

– mı acaba? yoksa insanın doğuştan getirdiği bazı özellikleri de var mı?

– insan vücudundaki katrilyonlarca hücreden tek bir tanesi, bu logu tutuyor olabilir.

– aslında bakarsan daha ilginç birşey oluyor. bilgiler, hologram şeklinde saklanır… bir hologram plakasını ikiye kessen de aynı görüntüyü verir…

– insanın öldükten sonra yeniden doğması olayı, dinlerde hep geçer. toprağa karışmış bu logu bulmak, onu diriltmek içi yeterlidir aslında.

– demek istediğini anladım. ama; toprağa karışan bu logu bulabilecek bir, ummm, “varlık”, muhtemelen aynı hücre yapısını toprağın herhangi bir yerinde bularak bir araya getirebilir ve ortaya aynı insanı tekrar çıkarabilir. artı üzerine logu da koyarsan, evet, dediğin noktaya gider olay. ancak… benim az önce sorduğum soru yine gündeme geldi… söylediğinde bulduğum tek gedik şu: şimdi diyelim ki bu varlık şu anda geldi, topraktan benim DNAlarımın aynısını çekip çıkardı hızla büyüttü ve benim TAMAMEN aynım bir KEREM2 yarattı. benim log hücremi de kopyaladı ve KEREM2’nin bünyesine kattı. şimdi iki tane KEREM var. ama… buna rağmen ben başka bir insanım o başka bir insan. ben aynı anda ikimizi birden deneyimlemiyorum. o kendini deneyimliyor ben de kendimi. yani ortaya çıkan insan tamamen aynı özellikleri de taşısa bir başkası olacaktır. bir başka bilinç, kendi kendini algılayan bir başka süje. aynı Class’dan yaratılmış bir başka Object.

– evet, ilginç bir nokta. eğer ben yaşlandığımda genç bir klonum olsaydı ve buna her bildiğimi aktarsaydım, ben öldüğümde yaşamaya devam eder miydim?

– etmezdin… işte şimdi demek istediğimi anlatabildim.

– zor bir soru. bana göre hayır, başka herkese göre evet…

– “neden ben benim de sen sensin” derken demek istediğim de buydu.

– uh…

– aslında bakarsan bizler, okyanustan alınmış birer bardak suyuz. o suyu okyanusa geri dök ve bir başka bardak su al. ortaya aynı şey çıkar mı? aynı derede iki kez yıkanabilir misin? ama daha da derine inersen, ne fark eder? okyanus okyanustur.

– ilerde bir cennet vaadi var. o cennette yaşayan ben mi olacağım?

– bu konuda ancak inancımı paylaşabilirim… “evet”… ama benim dediğim kadar derin bakıyorsan olaya, cennet de okyanusun bir başka formudur sadece… aslında ben “ne fark eder bilgisayara virüs girse? sonuçta herşey 1 ve 0” diyorum bir yerde.

Leave a Reply

Fill in your details below or click an icon to log in: Logo

You are commenting using your account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s